16Likes
LinkBack URL
About LinkBacks
Reply With QuoteAll I can do is look at its characteristics and say what I see. I think you may have those 2 mords wixed up lol im starting some jacks too even tho im not a big fan
not to be rude, but no one... no one has answers for your pheno questionsOriginally Posted by Brandawg92
now if you start asking about genotypes you might get somewhere... should go read and understand the difference between the 2... will be of help
All I can do is look at its characteristics and say what I see. I think you may have those 2 mords wixed up lol im starting some jacks too even tho im not a big fan
who is to say this wont also extract your THC and CBD's?
genotype defines plant traits, certain growing characteristics eg, 2 seeds from same plant that grow differently, smell differently etc
phenotype is genotype influenced by environment, eg if you took 2 clones off 1 plant and grew 1 indoors and one outdoors with diff fertilizers, that genotype has then been influenced upon by the enviroment. phenotypes are UNIQUE to each grow room. PERIOD!
Phenotype is any trait or behavior that can be observed. Genotype is any and every gene an organism contains, expressed or not. Environmental infuences dont hava any effect on genes unless its something that causes mutations. Again, I thimk you dun got your mords wixed up
lol newbs. phenotypes and genotypes...Wikipedia has all your answers lol.... in this case Oakleys righactually on every point that has been discussed so far he has been correct.
Genotypes cant be obsreved so how can you discuss it? Phenos can be infulenced but a black guy will never b white no matter how much he avoids sunlight. All you can do is discuss observable features unless you can map out the entire genome of a single cannabis plant o.o doubt it. So just hypothetically speaking how do you know anything about your plants gonotype? And yea this is all in wiki!
Either way i dont think anyone here knows about chem so if anyone knows where i can find out about chem PHENO 91 Chem PHENO D or chem PHENO 4 that would be appreciated
A phenotype (from Greek phainein, 'to show' + typos, 'type') is the composite of an organism's observable characteristics or traits: such as its morphology, development, biochemical or physiological properties, phenology, behavior, and products of behavior (such as a bird's nest). Phenotypes result from the expression of an organism's genes as well as the influence of environmental factors and the interactions between the two.
The genotype is the genetic makeup of a cell, an organism, or an individual (i.e. the specific allele makeup of the individual) usually with reference to a specific character under consideration.[1] For instance, the human CFTR gene, which encodes a protein that transports chloride ions across cell membranes, can be dominant (A) as the normal version of the gene, or recessive (a) as a mutated version of the gene. Individuals receiving two recessive alleles will be diagnosed with Cystic fibrosis. It is generally accepted that inherited genotype, transmitted epigenetic factors, and non-hereditary environmental variation contribute to the phenotype of an individual.
seriously. arguing with me is a bad idea.
So if i asked you "what is the genetic make up of your plant?" Then asked "what are the physical, observable characteristics of your plant?" Which would be easier to answer? Would you start going ataaatacatatagagaggaaacacaccaatttata? Haha come on dude you cant be serious posting defintions that repeat the last thing i just said.
Posting Permissions
Bookmarks